Review



cell lines rpmi8226 atcc  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    ATCC cell lines rpmi8226 atcc
    Cell Lines Rpmi8226 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 594 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+rpmi8226+atcc/RPMI+8226/pm40372919-219-182-185
    Average 96 stars, based on 594 article reviews
    cell lines rpmi8226 atcc - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025 .. Human cell lines RPMI8226, MM1S, H929, U266, ARP1 and OCI-My5 were cultured in RPMI1640 medium (Gibco, 11875093, Massachusetts, USA) with 10% fetal bovine serum (Gibco, 10099141C) and 1% penicillin-streptomycin (Beyotime, C0222, Shanghai, China) at 37◦C with 5% CO2.

    CCK-8 Assay:

    Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025 .. Human cell lines RPMI8226, MM1S, H929, U266, ARP1 and OCI-My5 were cultured in RPMI1640 medium (Gibco, 11875093, Massachusetts, USA) with 10% fetal bovine serum (Gibco, 10099141C) and 1% penicillin-streptomycin (Beyotime, C0222, Shanghai, China) at 37◦C with 5% CO2.

    Bicinchoninic Acid Protein Assay:

    Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025 .. Human cell lines RPMI8226, MM1S, H929, U266, ARP1 and OCI-My5 were cultured in RPMI1640 medium (Gibco, 11875093, Massachusetts, USA) with 10% fetal bovine serum (Gibco, 10099141C) and 1% penicillin-streptomycin (Beyotime, C0222, Shanghai, China) at 37◦C with 5% CO2.

    Multiple Displacement Amplification:

    Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025 .. Human cell lines RPMI8226, MM1S, H929, U266, ARP1 and OCI-My5 were cultured in RPMI1640 medium (Gibco, 11875093, Massachusetts, USA) with 10% fetal bovine serum (Gibco, 10099141C) and 1% penicillin-streptomycin (Beyotime, C0222, Shanghai, China) at 37◦C with 5% CO2.

    cDNA Synthesis:

    Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025 .. Human cell lines RPMI8226, MM1S, H929, U266, ARP1 and OCI-My5 were cultured in RPMI1640 medium (Gibco, 11875093, Massachusetts, USA) with 10% fetal bovine serum (Gibco, 10099141C) and 1% penicillin-streptomycin (Beyotime, C0222, Shanghai, China) at 37◦C with 5% CO2.

    Over Expression:

    Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025 .. Human cell lines RPMI8226, MM1S, H929, U266, ARP1 and OCI-My5 were cultured in RPMI1640 medium (Gibco, 11875093, Massachusetts, USA) with 10% fetal bovine serum (Gibco, 10099141C) and 1% penicillin-streptomycin (Beyotime, C0222, Shanghai, China) at 37◦C with 5% CO2.

    Polymerase Chain Reaction:

    Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025 .. Human cell lines RPMI8226, MM1S, H929, U266, ARP1 and OCI-My5 were cultured in RPMI1640 medium (Gibco, 11875093, Massachusetts, USA) with 10% fetal bovine serum (Gibco, 10099141C) and 1% penicillin-streptomycin (Beyotime, C0222, Shanghai, China) at 37◦C with 5% CO2.



    Similar Products

    cell lines rpmi8226 atcc  (ATCC)
    96
    ATCC cell lines rpmi8226 atcc
    Cell Lines Rpmi8226 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+rpmi8226+atcc/RPMI+8226/pm40372919-219-182-185
    Average 96 stars, based on 1 article reviews
    cell lines rpmi8226 atcc - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    human rpmi8226 cell line  (ATCC)
    90
    ATCC human rpmi8226 cell line
    Human Rpmi8226 Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+rpmi8226+atcc/Peptoniphilus+asaccharolyticus/pmc09649770__41467_2022_34654_MOESM7_ESM-35-0-3
    Average 90 stars, based on 1 article reviews
    human rpmi8226 cell line - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    human myeloma rpmi8226 cell line  (ATCC)
    99
    ATCC human myeloma rpmi8226 cell line
    Percentage of growth inhibition for increasing activity of 212 Pb-mAbs. <t>RPMI8226</t> cell growth inhibition percentage was calculated, from day 1 to day 4, using untreated cells as controls on same day. Growth inhibition is calculated as [(1 – OD treatment /OD control ) × 100] ± SEM. OD = optical density.
    Human Myeloma Rpmi8226 Cell Line, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+rpmi8226+atcc/RPMI-1640+Medium/pmc07383085-27-1-6
    Average 99 stars, based on 1 article reviews
    human myeloma rpmi8226 cell line - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Percentage of growth inhibition for increasing activity of 212 Pb-mAbs. RPMI8226 cell growth inhibition percentage was calculated, from day 1 to day 4, using untreated cells as controls on same day. Growth inhibition is calculated as [(1 – OD treatment /OD control ) × 100] ± SEM. OD = optical density.

    Journal: Journal of Nuclear Medicine

    Article Title: 212 Pb α-Radioimmunotherapy Targeting CD38 in Multiple Myeloma: A Preclinical Study

    doi: 10.2967/jnumed.119.239491

    Figure Lengend Snippet: Percentage of growth inhibition for increasing activity of 212 Pb-mAbs. RPMI8226 cell growth inhibition percentage was calculated, from day 1 to day 4, using untreated cells as controls on same day. Growth inhibition is calculated as [(1 – OD treatment /OD control ) × 100] ± SEM. OD = optical density.

    Article Snippet: The human myeloma RPMI8226 cell line (ATCC) was maintained in supplemented RPMI 1640 medium.

    Techniques: Inhibition, Activity Assay, Control

    Biodistribution of radiolabeled daratumumab (A and B) and isotypic control (C and D) in mice bearing RPMI8226 xenograft. (A and C) For postmortem biodistribution studies, mice were injected with 185 kBq of 212 Pb-daratumumab (A) or 212 Pb-isotypic control (C). Radioactivity in tumor, organs, and blood was expressed as %ID/g. Radioactivity in tumor significantly differs between the 2 mAbs ( P < 0.001). (B and D) For in vivo imaging studies, 7.4 MBq of 203 Pb-daratumumab (B) or 212 Pb-isotypic control (D) were injected. Mice were imaged by small-animal SPECT/CT 2, 6, 24, 48, and 96 h after injection. Tumors are indicated by arrows. Ing. LN = inguinal lymph node; Mes. LN = mesenteric lymph node; MIP = maximum-intensity projection.

    Journal: Journal of Nuclear Medicine

    Article Title: 212 Pb α-Radioimmunotherapy Targeting CD38 in Multiple Myeloma: A Preclinical Study

    doi: 10.2967/jnumed.119.239491

    Figure Lengend Snippet: Biodistribution of radiolabeled daratumumab (A and B) and isotypic control (C and D) in mice bearing RPMI8226 xenograft. (A and C) For postmortem biodistribution studies, mice were injected with 185 kBq of 212 Pb-daratumumab (A) or 212 Pb-isotypic control (C). Radioactivity in tumor, organs, and blood was expressed as %ID/g. Radioactivity in tumor significantly differs between the 2 mAbs ( P < 0.001). (B and D) For in vivo imaging studies, 7.4 MBq of 203 Pb-daratumumab (B) or 212 Pb-isotypic control (D) were injected. Mice were imaged by small-animal SPECT/CT 2, 6, 24, 48, and 96 h after injection. Tumors are indicated by arrows. Ing. LN = inguinal lymph node; Mes. LN = mesenteric lymph node; MIP = maximum-intensity projection.

    Article Snippet: The human myeloma RPMI8226 cell line (ATCC) was maintained in supplemented RPMI 1640 medium.

    Techniques: Control, Injection, Radioactivity, In Vivo Imaging, Single Photon Emission Computed Tomography